Instructions

Which of the f ollowing could not be the recognition site of a restriction endonuclease? a. GAATTC CTTAAG b. ATCGAT TAGCTA c. CTGCAG GACGTC d. GCTTGC CGAACG e. GGATCC CCTAGG 4. If the following DNA was cut with BAM HI what fragments would result? 5′ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3′ 3′ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5′

Order with us today for a quality custom paper on the above topic or any other topic!

What Awaits you:

• High Quality custom-written papers

• Automatic plagiarism check

• On-time delivery guarantee

• Masters and PhD-level writers

• 100% Privacy and Confidentiality