Instructions

Fill in the blanks in the table below regarding the similarities and differences between DNA replication and transcription (10 marks) DNA replication Transcription Polymerase moves along DNA template from 5 to 3′ or 3 to 5″? What is the molecule synthesized? Is primase required? (Yes/No) Polymerase has 3 to 5 exonuclease activity? (Yes/No) Is the molecule synthesized complementary to the template? (Yes/No) 2. a Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5′ and 3) of the two DNA strands. (12 marks) +1 -10 -35 JTTACATCCGAARCOTACCATCAECACIENTTREGATCGCACTAGOGICE AGCS. …5AMCGTAGOCTTTGCATGCTAOCENCGOTGATAATTAGCCTGATACCAGCATC3.. I 6) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the Sand 3ends from left to right of the RNA strand. (2 marks) (1) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (1 mark) b. Below is the sequence of DNA template of a gene SATGTACAAGGTCGGATGA 3 ( Write the sequence of RNA transcribed from this template Indicate the S’ and ‘ends from left to right of the RNA sequence (2 marks) (1) Under the RNA sequence in (1), write the corresponding anticodon sequence. Be sure to indicate the 5 and the two far ends of the anticodon sequence (2 marks) (i) Under the anticodon sequence in (), write the corresponding amino acids coded. Use l-letter abbreviation to represent the amino acids. Also indicate the N-terminus and terminus in this peptide (5 marks) 7 Seond letter Phe UU Lew CAC First letter UUU UCU UAU Tyr UGU U UCC UAC Ser Cys UOC VUA UCA Leu UAA Stop UGA Stop A VUG UCG UAG Stop UGG Tp G CUU CCU CAU CGU CUC ccc His CGC CUA CCA Pro CA COA Arg CUG CCG Gin CAG CGG AUU ACU AAU AGU AUCH ACO AAC Aan AOC Ser Thr AUA ACA MMA AGA AUG Mel ACO AGO Arg GUU GCU GAU GGU U GUC GCC Аер GAC 000 Val AR GUA GCA Gly GAA GGA GUG GCG GAG GGG DU COU O O O OCO Third letter AAGL 3. a. The figure below shows a llama, a relative of the camel. One amino acid in camel haemoglobin B subunits has been replaced by a different amino acid in llama haemoglobindo subunits. Llamas live at high altitudes and camels live at low altitudes. At high altitudes the partial pressure of oxygen is low, The figure shows dissociation curves for llama haemoglobin and carnel haemoglobin. 100 llama 80 camel saturation of 60 haemoglobin 40- (%) with oxygen 20 0 0 2 16 4 6 8 10 12 14 partial pressure of oxygen (kPa) wapicu What is the partial pressure of oxygen that results in a saturation of 50% in llama and camel hemoglobin? (2 marks) m Explain why it is important for the survival of the lama that the Ilama haemoglobin dissociation curve is to the left of the camel haemoglobin dissociation curve. (2 marks) . Complete the table regarding the affinity of oxygen in myoglobin and haemoglobin. In the blank, write “increase the affinity”, “Fecrease the affinity” or no change in affinity” (4 marks) Myoglobin Haemoglobin decrease in the partial pressure of C), in the lungs Asics in the level Q 1 2 # 3 $ 4 % 5 6 & 7

Place your order now for a similar paper and have exceptional work written by our team of experts to guarantee you A Results

Why Choose US:

11+ years of experience on custom writing

90% Return Client

Urgent 3 Hrs Delivery

Your Privacy Guaranteed

Unlimited Free Revisions

Money Back Guarantee