Instructions

Which of the following scenarios was created through genetic engineering? The gene that codes for insulin production was inserted into a bacterium and then the bacterium is used to produce insulin. A bacterium that is growing in the lab develops resistance to an antibiotic. One plant variety is hybridized with another variety to select for a desirable trait such as large fruit production. O When insulin is extracted from a pig and used to treat human diabetes. Which of the following restriction enzyme cut sites would produce blunt ends? EcoRI cuts after the “G” in GAATTO O Smal cuts after the third “C” in CCCGGG Sacl cuts after the “T” in GAGCTC O Hindill cuts after the first “A” in AAGCTT Which of the following statements about DNA probes are false? Probes are typically composed of double stranded pieces of DNA. O Probes can be labeled with radioactive phosphorus to facilitate detection. Probes can be labeled with a fluorescent dye to facilitate detection. o Probes are typically composed of single stranded pieces of DNA. Which direction will DNA fragments migrate if this gel was initiated to run? + Credit: modified “Gel electrophoresis e” figure 12.14a from OpenStax Microbiology e adapted from Magnus Manske is licensed under CC BY 4.0 e. up left right down Below is an image of a gel electrophoresis. The lanes with ladders are labeled with “L” and the sample lanes are labeled 1-7. The sizes of some of the bands in the ladder lanes have been labeled. Estimate the size of the DNA fragment in lane 4. Choose all correct answers, L 1 2 3 4 5 6 7 L 500 300 100 L 1 2 3 4 5 6 7 L 2 3 4 5 Credit: Modified “Agarose gel e “adapted from figure 12.140 OpenStax Microbiology e who adapted from James Jacob is licensed under CC BY 4.0 e. 400 amino acids 400 nucleotides 300 nucleotides 300 base pairs In a PCR assay, what is the purpose of each temperature step. heating the sample to 50°C [Choose] heating the sample to 72°C [ Choose < heating the sample to 95°C ✓ [Choose] promotes synthesis of new DNA allows primers to anneal to the template DNA separates the DNA strands in the samples Why is it important to use a hyperthermophilic DNA polymerase in PCR? Because hyperthermophilic DNA polymerase is able to resist the saline reaction conditions. O Because hyperthermophilic DNA polymerase is able to resist denaturation at 95°C. Because only hyperthermophiles have DNA polymerases. Because hyperthermophilic DNA polymerase is faster than other polymerases. Consider the following image of one of the primer “AGCT” bound to its template in a PCR reaction. Which end of the primer would the polymerase attach to and begin copying DNA? 3′ TATCCGACAATCGATCGATTGCCTTCTAA 5′ AGCT Credit: “Primer Binding” by Mike Matiasek of Butte College is licensed under CC BY 4.02. O not enough information o either side would work O left side right side

Place your order now for a similar paper and have exceptional work written by our team of experts to guarantee you A Results

Why Choose US:

11+ years of experience on custom writing

90% Return Client

Urgent 3 Hrs Delivery

Your Privacy Guaranteed

Unlimited Free Revisions

Money Back Guarantee