Instructions

DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was made in 1978. The insulin gene was inserted into a plasmid and the gene was transcribed and translated from the plasmid in E coll cells. Insulin is synthesized by ribosomes in human pancreatic cells. Insulin is synthesized as a longer polypeptide, which is then trimmed by proteases to make the mature chains A and B (see Fig. 2.17 on page 39 of your textbook). Molecular biologists cloned the gene sequences of insulin chain A and B polypeptides into PBR322. This plasmid is shown below (figure from https://www.ncb.com/products/n3033-pbr322-vector). You can find more information about individual restriction enzymes at https://www.neb.com/tools-and-resources/interactive- tools/enzyme-finder. EcoRI 4359 Aatll – Zral 4284 lal – Bspl 23 Bill 4209 Hindill 29 E 4205 EcoRV 185 Sspl 4168 Earl 4155 Bmtl – Nhel 229 Acul 4048 Bamill 375 Xmal 3961 Spri 409 Hincll 3905 Ball 471 Scal 3844 Full 445 Bl 3787 Bel 528 tl 3759 Pul 3733 Sphl 562 EcoNl 622 Pstl 3607 Sall-Accl – Hincll 651 Bsrl 3602 Nh N 712 Asel 3537 Eagl 939 Bsal 3433 11 949 Bsrl 3420 Nrul 972 PBR322 -BAPI 1045 Ahdi 3361 4,361 bp Bsp MI-Bull 1063 Noul 3000 NwNI 2884 PMI 1315 Bl 1353 PAMI 1354 Styl 1369 Aval – BsoBl 1425 PMI 1438 Miscl 1444 Btel 1447 Pull 1480 Regl 1650 HspEl 1654 BsaBl 1668 Bell 2777 B 2682 Del 2575 Peil – Af 2473 Bal 2404 Earl 2351 lepỌI – Sape 2350 Ndel 2295 BAP 2291 BsZ171- Accl 2244 sal 2225 Th11ll. Pfli 2217 Xmal 2029 Pull 2054 EsmBI 2122 Drdi 2162 A) The gene of insulin (chain A) was inserted between the EcoRV and Nrul sites of PBR322. What palindromic sequences are recognized by these restriction enzymes? [Write their sequences below along with the cleavage sites.] What are the sizes of the DNA fragments after treating PBR322 with these restriction enzymes? B) The gene of insulin (chain B) was inserted between the Bsal and Acul sites of PBR322. The recombinant plasmid was transformed into E. coli cells. What was the antibiotic resistance of the cells? C) To express insulin in E. coli, the inserted DNA also included transcriptional and translational start and stop signals. The coding strand of the gene for chain A is written below (5 to 3′, left to right). GGCATCGTTGAACAGTGTTGCACTTCTATCTGCTCTCTTTACCAGCTTGAGAACTACTGTAAC What is the amino acid sequence of human insulin (chain A)? [Write its sequence on the line below.] D) Design a minimal DNA insert that would allow this polypeptide to be expressed in E. coli cells.

Order with us today for a quality custom paper on the above topic or any other topic!

What Awaits you:

• High Quality custom-written papers

• Automatic plagiarism check

• On-time delivery guarantee

• Masters and PhD-level writers

• 100% Privacy and Confidentiality