Instructions

What is the name of the nucleotide on the right? a. adenosine triphosphate c. deoxyadenosine diphosphate e. deoxyadenosine monophosphate b. deoxyganosine diphosphate d. guanosine monophosphate 18. H ow many phosphoester and phosphoanhydride bonds are in this nucleotide? Ou a. 2,0 b. 1,0 d. 0,1 e.1,1 9. Put the following three DNA sequences (only forward strand shown) in order of increasing melting temperature: 1) GGGATTCGTATCCTGACATC 2) GCATTGACCTCTGA 3) ATTCTTGAAACAAT 1,2,3 c. 2,3,1 b. 3,2,1 a. 2,1,3

Order with us today for a quality custom paper on the above topic or any other topic!

What Awaits you:

• High Quality custom-written papers

• Automatic plagiarism check

• On-time delivery guarantee

• Masters and PhD-level writers

• 100% Privacy and Confidentiality