Instructions

What would the amino acid sequence be for the following DNA Transcript: 5’AAGCCATTTAAAGGC 39 3′ TTCGGTAAATTTCCG 5′ a. Phe Gly Lys Phe Pro b. Phe Leu Lys Phe Val c. Lys Phe Phe Lys Pro d. Lys Pro Phe Lys Gly e. More information is needed Luc ULA UUG cou Forst Base AUU B00005000 Third Case AUC AUA AUG Met Start GUU GUC GUA OUD Please use the genetic code and the following DNA transcript to answer question 2. 3’TACCCCGGGCAAATTTACGGCAAATTTATCTACCCTAATTCCACTS’ 5’ATGGGGCCCGTITAAATGCCGTTTAAATAGATGGGATTAAGGTGA3′ 2. How many proteins are represented by this hypothetical nucleic transcript code? b. 5 c. 2 d. 4 e. More information is needed 3. At 2:00 pm, you measured intracellular arginine at 100M. After addition of 200M of arginine to the cell, you, at 2:45 pm, measured intracellular arginine levels to be still at 100M. The most likely explanation is: a. Arginine bound to the active site of the repressor protein b. Arginine bound to the allosteric site of RNA polymerase c. Arginine was in excess in the cell and acted as an inducer d. Arginine was in excess in the cell and bound to the operator e. Arginine bound to the allosteric site of the repressor protein 4. Inspector Gadget is looking for his archenemy, Mr. Biggs, who causes his human wictims to get sick in the lower gastrointestinal tract which is absent of oxygen. So therefore, Inspector Gadget classified Mr. Biggs as aſan) and a. psychrophile, obligate aerobe b. thermophile, microaerophile c. mesophile, facultative anaerobe d. acidophile, obligate anaerobe e. alkalophile, aerotolerant anaerobe 5. In Griffiths transformation experiments, which of the following did not take place? a. live, smooth pneumococci killed mice b. live rough bacteria were able to retrieve the DNA from dead, encapsulated bacteria and become virulent c. DNA was transferred from smooth to rough bacteria using conjugation d. dead, smooth pneumococci had no effect on mice 6. Sabourard’s agar has a low pH which encourages the growth of molds and discourages the growth of bacteria. Sabourard’s agar could best be described as being a. selective b. differential c. complex d. enriched e. chemically defined 7. Growth factors are a. compounds that are synthesized by fastidious organisms for growth b, compounds that must be provided to Neisseria gonorrheae for growth c. physical factors such as pH required for the growth of fastidious organisms d. inorganic e. compounds that must be provided to nonfastidious organisms for growth position and is inhibited by 8. The tryptophan operon is usually in the a/an __molecule. a. on, repressor b. off, inducer c. on, inducer d. off, repressor 9. Which of the following prevented an aerotolerant anaerobic, mesophilic and halophilic bacterium from contaminating your home aquarium? a. the water was at 37°C b. you placed a high amount of glucose into the aquarium c. you placed several pennies in the aquarium d. you were using a .45 um filtering unit e. you placed carbon dioxide instead of oxygen into the aquarium 10. CAP a. is involved in positive control b. stands for cyclic amp protein c. works in conjunction with CAMP d. is involved in negative control e. a & c 11. Which one of the following microorganisms would you use as a quality control check to ensure that your sterile technique method is properly working? a. S. aureus, a gram-positive bacterium b. E. coli, a gram-negative bacterium c. B. cereus, an endospore-forming bacterium d. M. leprae, an acid-fast bacterium e. T. pallidum, a flagellated, disease causing bacterium 12. A nucleotide is composed of a a. sugar, nitrogenous base, and phosphate b. sugar, nitrogenous base, and guanine c. sugar, nitrogenous base, and adenine d. sugar, nitrogenous base, and thymine e. sugar, nitrogenous base, and uracil

Order with us today for a quality custom paper on the above topic or any other topic!

What Awaits you:

• High Quality custom-written papers

• Automatic plagiarism check

• On-time delivery guarantee

• Masters and PhD-level writers

• 100% Privacy and Confidentiality